View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_53 (Length: 248)
Name: NF8172_low_53
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 23 - 155
Target Start/End: Complemental strand, 42155363 - 42155231
Alignment:
| Q |
23 |
aaaatttgtacagtatgcttatctgctatattatgaatgtttattgtcaaatttgttcagtatgcttatctactctattattaatttttattgttttgca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
42155363 |
aaaatttgtacagtatgcttatctgctatattatgaatgtttattgtcaaatttgttcagtatgtttatctactctattattaatttttatagttttgca |
42155264 |
T |
 |
| Q |
123 |
tgtctataatgaggacaatcatcgtgcaaacaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42155263 |
tgtctataatgaggacaatcatcgtgcaaacaa |
42155231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 154 - 236
Target Start/End: Complemental strand, 42154807 - 42154725
Alignment:
| Q |
154 |
aatgtaaaatatttgtatgctttcaatacattatacatatgaattaacttcatatttgtatgtaaaatatgtgtacgtgtgtg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42154807 |
aatgtaaaatatttgtatgctttcaatacattatacatatgaattaacttcatatttgtatgtaaaatatgtgtacgtgtgtg |
42154725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University