View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_62 (Length: 215)
Name: NF8172_low_62
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 28 - 125
Target Start/End: Original strand, 49542523 - 49542615
Alignment:
| Q |
28 |
gatgaaattgcagtgaggaccacatgccacattatattatgactggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc |
125 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49542523 |
gatgaaattgcaatgaggaccacatgccac-----actatgactggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc |
49542615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 49542656 - 49542734
Alignment:
| Q |
123 |
gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgcta |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49542656 |
gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgtttttta--ctcaattctctctgcta |
49542734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University