View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8173_high_15 (Length: 202)
Name: NF8173_high_15
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8173_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 54162026 - 54161850
Alignment:
| Q |
14 |
acaaacttggattttaaatttttgttctgcttgcgattgctgtatcgatggcaacagtttccccacacgctcttactggaattcgcattgttgtcgctgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54162026 |
acaaacttggattttaaatttttgttctgcttgcgattgctgtatcgatgg-aacagtttccccacacgttcttactggaattcgcattgttgtcgctgg |
54161928 |
T |
|
| Q |
114 |
agacaatggaactggcaagtccagtctaatagctactttcgctgccggaaactctgtcaaggatgttccgccagtatt |
191 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54161927 |
agacgatggaactggcaagtccagtctaatcgctactttcgctgccggaaactctgtcaaggatgttccgccggtatt |
54161850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University