View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8173_high_8 (Length: 282)
Name: NF8173_high_8
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8173_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 88 - 266
Target Start/End: Original strand, 32847238 - 32847413
Alignment:
| Q |
88 |
tataatagcacgtggcagttaaaattaagatcatgcttaagaggtaatcttatgttgaattgtgaattcctattggttttgtgattgtacaaatcttaca |
187 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847238 |
tataatagcacgtgactgttaaaattaagaacatgcttaagaggtaatcttatgttgaattgtgaattcctattggttttgtgattgtacaaatcttaca |
32847337 |
T |
 |
| Q |
188 |
tcaattgagggatattcaggtccttttctcagatgataaaattaacaatagcaggaacgtgcgagaccataccatatct |
266 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847338 |
tcaattgagggatattcaggttcttttctca---gataaaattaacaatagcaggaacgtgcgagaccataccatatct |
32847413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University