View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8173_low_12 (Length: 242)
Name: NF8173_low_12
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8173_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 47495010 - 47494831
Alignment:
| Q |
18 |
aacccacatcctgtcaaacattcaatacttnnnnnnntggcctcaaatctcaacattaattaatgctaacaattaaaacattccagaataatgtttaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47495010 |
aacccacatcctgtcaaacattcaatacttaaaaaaatggcctcaaatctcaacattaattaatgctaacaattaaaacattccagaataatgtttaact |
47494911 |
T |
 |
| Q |
118 |
tactcaaacatgatttaaccataaattatactttcaactttag---aattgatcctagtcccaaaatcaattctatctaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47494910 |
tactcaaacatgatttaaccataaattatactttcaactttagaataattgatcctagtcccaaaatcaattctatctaa |
47494831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 193 - 242
Target Start/End: Complemental strand, 47494615 - 47494565
Alignment:
| Q |
193 |
aatgaaaacataacataataatacagt-tatgtgcaacaaaatgctcatgc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47494615 |
aatgaaaacataacataataatacagtgtatgtgcaacaaaatgctcatgc |
47494565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University