View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8173_low_16 (Length: 206)

Name: NF8173_low_16
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8173_low_16
NF8173_low_16
[»] chr2 (1 HSPs)
chr2 (75-189)||(4233279-4233393)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 75 - 189
Target Start/End: Complemental strand, 4233393 - 4233279
Alignment:
75 aattagggaaataacgatatatagcaaaggttgcttgtaggttacgttttggcgactatgctcgtgtggatacgtatcatccaaggaatacatgcggcct 174  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
4233393 aattagggaaataacgatatatagcaaaggttgcttgtaggttacgttttggcggctatgctcgtgtgaatacgtatcatccaaggaatacatgcggcct 4233294  T
175 acctagctagatagt 189  Q
    |||||||||||||||    
4233293 acctagctagatagt 4233279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University