View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8173_low_17 (Length: 202)

Name: NF8173_low_17
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8173_low_17
NF8173_low_17
[»] chr4 (1 HSPs)
chr4 (14-191)||(54161850-54162026)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 54162026 - 54161850
Alignment:
14 acaaacttggattttaaatttttgttctgcttgcgattgctgtatcgatggcaacagtttccccacacgctcttactggaattcgcattgttgtcgctgg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
54162026 acaaacttggattttaaatttttgttctgcttgcgattgctgtatcgatgg-aacagtttccccacacgttcttactggaattcgcattgttgtcgctgg 54161928  T
114 agacaatggaactggcaagtccagtctaatagctactttcgctgccggaaactctgtcaaggatgttccgccagtatt 191  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||    
54161927 agacgatggaactggcaagtccagtctaatcgctactttcgctgccggaaactctgtcaaggatgttccgccggtatt 54161850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University