View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8173_low_8 (Length: 309)
Name: NF8173_low_8
Description: NF8173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8173_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 23893746 - 23893974
Alignment:
| Q |
1 |
ttccttcattccatcattcattagccgtccacatatatttaggatatgatcactatttggatttggatataagtgcaagatccaattgcactaacttgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23893746 |
ttccttcattccatcattcattagccgtccacatatatttaggatatgatcactatttggatttggatataagtgcaagatccaattgcactaacttgta |
23893845 |
T |
 |
| Q |
101 |
ttctattgtgttttgattcattgtactttatatcaactacaccgacgaaacttatttggaatcgctgtgattttgtaaaagctatactttgtaaattgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23893846 |
ttctattgtgttttgattcattgtactttatatcaactacaccgacgaaacttatttggattcgctgtgattttgtaaaagctatactttgtaaattgta |
23893945 |
T |
 |
| Q |
201 |
gcttaaacaaaatcatggtgtcatcgtga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23893946 |
gcttaaacaaaatcatggtgtcatcgtga |
23893974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 206 - 293
Target Start/End: Complemental strand, 7211706 - 7211619
Alignment:
| Q |
206 |
aacaaaatcatggtgtcatcgtgatttcgtcaaaggatatagaatatagcgaaggaggatagggaacttactaaatgtaccaagatac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211706 |
aacaaaatcatggtgtcatcgtgatttcgtcaaaggatatagaatatagcgaaggaggatagggaacttactaaatgtaccaagatac |
7211619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University