View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_high_12 (Length: 507)
Name: NF8175_high_12
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 213 - 497
Target Start/End: Complemental strand, 4661869 - 4661585
Alignment:
| Q |
213 |
aagtggtcataatattgaagataagtccgaccaccacgccgacattggtgtcgatgtgtcagtgtcaacgcttcatatatcataatcatggccctaaacg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661869 |
aagtggtcataatattgaagataagtccgaccaccacgccgacattggtgtcgatgtgccagtgtcaacgcttcatatatcataatcatggccctaaacg |
4661770 |
T |
 |
| Q |
313 |
gtagggaccatcagccatgtaatgaccatccatataaagagctgcactctgtggatgcagtccatccatcaccataaactgcatgtcttctgatggtttc |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661769 |
gtagggaccatcagccatgtaatgaccatccatataaagagctgcactctgtggatgcagtccatccatcaccataaactgcatgtcttctgatggtttc |
4661670 |
T |
 |
| Q |
413 |
cagtgcctcttcctttgatttatgaaccagttatttatttgcttctggtccaaacctgttgactcagccaatgctaccttctctg |
497 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661669 |
cagtgcctcttcctttgatttatgaaccagttatttatttgcttctggtccaaacctgttgactcagccaatgctaccttctctg |
4661585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 4662078 - 4661905
Alignment:
| Q |
19 |
acactgacaaagaaaacaattaatatgggaaaaactgaaacattcacactgcacaagcataaccaagtttcatactatgcttgtcataatactttgaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4662078 |
acactgacaaagaaaacaattaatatgggaaaaactgaaacattcacactgcacaagcataaccaagtttcatgttatgcttgtcataatactttgaaac |
4661979 |
T |
 |
| Q |
119 |
tagaactatatgtaaatataatgctgactgatacagtttaaacagtctttgattgtttcaccttccacttaaac |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661978 |
tagaactatatataaatataatgctgactgatacagtttaaacagtctttgattgtttcaccttccacttaaac |
4661905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 398 - 456
Target Start/End: Original strand, 37489242 - 37489300
Alignment:
| Q |
398 |
tcttctgatggtttccagtgcctcttcctttgatttatgaaccagttatttatttgctt |
456 |
Q |
| |
|
||||| |||||||||||||| || ||||| ||||| |||||||| |||||||| ||||| |
|
|
| T |
37489242 |
tcttcagatggtttccagtgtcttttcctctgattgatgaaccaattatttatctgctt |
37489300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 376 - 474
Target Start/End: Original strand, 8791891 - 8791989
Alignment:
| Q |
376 |
atccatcaccataaactgcatgtcttctgatggtttccagtgcctcttcctttgatttatgaaccagttatttatttgcttctggtccaaacctgttga |
474 |
Q |
| |
|
||||||||||| |||||||||||| ||||| || |||||||||| ||||||||||| || |||||||| |||||||||||||| || | ||||||||| |
|
|
| T |
8791891 |
atccatcaccacaaactgcatgtcctctgaaggcttccagtgccgtttcctttgattaataaaccagttgtttatttgcttctgatcaagacctgttga |
8791989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 376 - 459
Target Start/End: Original strand, 8780396 - 8780481
Alignment:
| Q |
376 |
atccatcaccataaactgcatgtcttctgatggtttccagtgcctcttcctttgattt--atgaaccagttatttatttgcttctg |
459 |
Q |
| |
|
||||||||||| |||||||||||| ||||| || |||||||||| || ||||||||| || |||||||| |||||||||||||| |
|
|
| T |
8780396 |
atccatcaccacaaactgcatgtcctctgaaggcttccagtgccgttttctttgattttaataaaccagttgtttatttgcttctg |
8780481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 412 - 456
Target Start/End: Original strand, 48282094 - 48282138
Alignment:
| Q |
412 |
ccagtgcctcttcctttgatttatgaaccagttatttatttgctt |
456 |
Q |
| |
|
||||| ||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
48282094 |
ccagttccttttcctttgattaataaaccagttatttatttgctt |
48282138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University