View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_high_70 (Length: 243)
Name: NF8175_high_70
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_high_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 34791315 - 34791090
Alignment:
| Q |
1 |
tggtgagagtgctatagttggttaaactaaaatgcatctgataaatattgttagaaatgtttttataatgaaatnnnnnnntagtattggatacttgctt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34791315 |
tggtgagagtgctaaagttggttaaactaaaatgcatctgataaatattgttagaaatgtttttataatgaaataaaaaaatagtattggatacttgctt |
34791216 |
T |
|
| Q |
101 |
ggtatgtatcacaaagtatcacacccatgtcgatatcaaacatgtgtgtgatatcgatactttgccatgtttgaagtattctgtgcttcatagttgcaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34791215 |
ggtatgtatcacaaagtatcacacccatgtcgatatcaaacatgtgtgtgatatcgatactttgccatgttcgaagtattctgtgcttcatagttgcaga |
34791116 |
T |
|
| Q |
201 |
taagttattgcc-ttttatttgtcat |
225 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
34791115 |
taagttattgcctttttatttgtcat |
34791090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University