View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_high_71 (Length: 241)
Name: NF8175_high_71
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_high_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 2646749 - 2646526
Alignment:
| Q |
1 |
tcccactcccttcccatgcttctaaccaattttaaagttttgaagaaagaataatgatcctatatgcactttgcatccattatcataccaataaatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2646749 |
tcccactcccttcccatgcttctaaccaattttaaagttttgaagaaagaataatgatcctatatgcactttgcgtccattatcataccaataaatttta |
2646650 |
T |
|
| Q |
101 |
acaaaatgaagttgtagcccactgccaaagtaaatgttcaaaattcaaagtaacctctctttggaattgaagcacgaatttcctttatctctttttctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2646649 |
acaaaatgaagttgtagcccactgccaaagtaaatgttcaaaattcaaagtaacctctctttggaattgaagcacgaatttcctttatctctttttctct |
2646550 |
T |
|
| Q |
201 |
cctttaaattttattgattccatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2646549 |
cctttaaattttattgattccatt |
2646526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University