View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_high_78 (Length: 233)
Name: NF8175_high_78
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_high_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 24706655 - 24706864
Alignment:
| Q |
1 |
aataggggaacgacaaagattcagtgattttaataatgcgaataacataactgatggactgatctttctacaaagttccgaacaaagtcacttagttgta |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24706655 |
aataggggaacgacaaagagacagtgattttaataatgcgaataacataacttatggactgatctttctacaaagttccgaacaa-gtcacttagttgta |
24706753 |
T |
 |
| Q |
101 |
agaccacttttcaaccacgtggtactcggttcgagactgaacatttggaaattttcaaccaagtttattaactgctgtcaaatcactgtcttttgtgtgg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24706754 |
agaccacttttcaaccttgtggtactcggttcgagactgaacatttggaaattttcaaccaagtttattaactgctgtcaaatcactgtcttttgtgtgg |
24706853 |
T |
 |
| Q |
201 |
ttgcattgtga |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
24706854 |
ttgcattgtga |
24706864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University