View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_44 (Length: 322)
Name: NF8175_low_44
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 49905334 - 49905043
Alignment:
| Q |
19 |
aaaaggaccaaaaacttgggcatcagggtaaagaattttcgataaataggtataggaaagtaacttgtgcataatgttaatgtacaatacaatacaagtc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905334 |
aaaaggaccaaaaacttgggcatcagggtaaagaattttcgataaataggtataggaaagtaacttgtgcataatgttaatgtacaatacaatacaagtc |
49905235 |
T |
 |
| Q |
119 |
ccagggtgagagaatcagtgtcatcatattctnnnnnnnnnnnnnaatactcataacatcatttactcttgcagagtggggggccaaagctcttttctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49905234 |
ccagggtgagagaatcagtgtcatcatattctcccccaaccccccaatactcataacatcatttactcttgcagagtggggggccaaagctcttttctgt |
49905135 |
T |
 |
| Q |
219 |
tttaggggtcccctgcatttttaagggagaatatgttcttttcattttggctttcaattccctattttgatgaataccagtctattcttctc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49905134 |
tttaggggtcccctgcatttttaagggagaatatgttcttttcattttggctttcaattccctattttgatgaataccaatctattcttctc |
49905043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University