View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_45 (Length: 321)
Name: NF8175_low_45
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 133 - 300
Target Start/End: Complemental strand, 35786868 - 35786701
Alignment:
| Q |
133 |
gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcatcatcatcaccaaccagttttcta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786868 |
gtcctttacttcctcgtccttctggtttctcagtttacaataattttgtcccatttggtgtttacaataattttcatcatcatcaccaaccagttttcta |
35786769 |
T |
|
| Q |
233 |
taataacaataatggtttagttcattttcatcataaccctcatcaagaaatggtgcaagtgcaagtgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786768 |
taataacaataatggtttagttcattttcatcataaccctcatcaagaaatggtgcaagtgcaagtgc |
35786701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 35786990 - 35786958
Alignment:
| Q |
11 |
tattattctctatggttctagggctcagcttaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35786990 |
tattattctctatggttctagggctcagcttaa |
35786958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University