View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_49 (Length: 307)
Name: NF8175_low_49
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 956368 - 956550
Alignment:
| Q |
19 |
atattagtcatcagttactaatattccatgtttctatctcttcataaa-tattgatatgtggaggaannnnnnnagtttatgcctctatatgaatggctt |
117 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
956368 |
atattattcatcacttactaatattccatgtttctatctcttcataaactcttgatatgtggaggaatttttttagtttatgcctctatatgaatggctt |
956467 |
T |
|
| Q |
118 |
tataaacggaacaccacttttaataaaagtttccattacaatatttgaaccttcattgttgttcatgctagcttcaggtcatg |
200 |
Q |
| |
|
|| ||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
956468 |
tacaaacggaacactacctttaataaaagtttccattgcaatatttgaaccttcattgttgttcatgctagctttaggtcatg |
956550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 288
Target Start/End: Original strand, 956552 - 956581
Alignment:
| Q |
259 |
tcgtgctcctggtggatatgtctatgtttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
956552 |
tcgtgctcctggtggatatgtctatgtttc |
956581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University