View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_65 (Length: 260)
Name: NF8175_low_65
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_65 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 40698201 - 40697953
Alignment:
| Q |
12 |
gaacctgtgctatttacatggtacatggtgctttatgttttcaatgtttttgttttagatttagaaatggtgcttgaactaaacctgcagaattatggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40698201 |
gaacctgtgctatttacatggtacatggtgctttatgttttcaatgtttttgttttagatttagaaatggtgcttgaactaaacatgcagaattatggtt |
40698102 |
T |
 |
| Q |
112 |
ttgttatgcataggaatggcatacaacaaaggcaaaattcttggcaagatggagtgtctggtacaaattgccctatccaacctcaaacaaattggactta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40698101 |
ttgttatgcataggaatggcatacaacaaaggcaaaattcttggcaagatggagtgtctggtacaaattgccctatccaacctcaaacaaattggactta |
40698002 |
T |
 |
| Q |
212 |
tgtttttgaaactaaagaccagattggtacattcttctatttcccttcc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40698001 |
tgtttttgaaactaaagaccagattggtacattcttctatttcccttcc |
40697953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 166
Target Start/End: Original strand, 6796776 - 6796820
Alignment:
| Q |
122 |
taggaatggcatacaacaaaggcaaaattcttggcaagatggagt |
166 |
Q |
| |
|
|||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
6796776 |
taggaatggcattaaacaaaggaaaaattcatggcaagatggagt |
6796820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University