View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_67 (Length: 256)
Name: NF8175_low_67
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 9449303 - 9449527
Alignment:
| Q |
14 |
cagagaccaaactaaatacattcccaaacggttgggacttcgatagcggaagccatgaatggttaaaagaggatctaaccatattttttatgtcgaaaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9449303 |
cagagaccaaactaaatacattcccaaacggttgggacttcgatagcggaagccatgaatggttaaaggaggatctaaccatattttttatgtcgaaaat |
9449402 |
T |
 |
| Q |
114 |
tgctcttctcccttttagacttggtcattaccttaaatacattgtaatagttaactgttcgcccgctgacacttttaagatcggctcattctattataca |
213 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9449403 |
tgctcttctcccttttagactagatcattcccttaaatacatcgtaatagttaactgttctcccgctgacacttttaaaatcggctcattctattataca |
9449502 |
T |
 |
| Q |
214 |
ctaatcatatatatgagaagaatga |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9449503 |
ctaatcatatatatgagaagaatga |
9449527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University