View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_75 (Length: 249)
Name: NF8175_low_75
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 5350939 - 5351178
Alignment:
| Q |
1 |
ccccaatctcgaatttaattcgataccttggaccataagcataccccacacagatctaaatatacattaattatttcaaccgtaccattcatttgcattt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5350939 |
ccccaatcccgaatttaattcgataccttggaccataagcataccccacacagatctaaatatacattaattatttcaaccgtaccattcatttgcattt |
5351038 |
T |
 |
| Q |
101 |
atatttgtataaatacccattcccttctcttccaaatcacaactcgattcacaaatcacattacattttacatttacaacatttgccacattgattaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5351039 |
atatttgtataaatacccattcccttctcttccaaatcacaactcgattcacaaatcacattacattttacatttacaacatttgccacattgattaaca |
5351138 |
T |
 |
| Q |
201 |
agtaacatggctggagcaattaaggttgttgctatctctg |
240 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5351139 |
aataacatggctggagcaattaaggttgttgctatctctg |
5351178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 228
Target Start/End: Original strand, 5343417 - 5343504
Alignment:
| Q |
134 |
aaatcacaactcgattcacaaatcacattacattttacatttacaacatttgccacattgattaacaagtaacatggctggagcaattaaggttg |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| | ||||||||||||||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
5343417 |
aaatcacaactcaattcacaaatcacatcacatat-------acaacatttgccacattgattcacaaaaaacatggctgggataattaaggttg |
5343504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University