View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_84 (Length: 237)
Name: NF8175_low_84
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 88 - 223
Target Start/End: Complemental strand, 39305545 - 39305409
Alignment:
| Q |
88 |
cactcgagggacaagttagaattattttttctctcacaaaagaagttaaaatggctaaatcaattctattagagaatatctaagcattctctgtctctc- |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305545 |
cactcgagggacaagttagaattattttttctctcacaaaagaagttaaaatggctaaatcaattctattagagaatatctaagcattctctgtctctca |
39305446 |
T |
 |
| Q |
187 |
nnnnnnnntctaagcattctcttagcacgtcaaaatt |
223 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
39305445 |
aaaaaaaatctaagcattctctaagcacgtcaaaatt |
39305409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University