View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_88 (Length: 234)
Name: NF8175_low_88
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_88 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 50 - 218
Target Start/End: Complemental strand, 34971882 - 34971714
Alignment:
| Q |
50 |
tcaatgagttcaataagcaaagctccttctaacaataacatgataagttttgagtcttctgaggagagtagttggaccaagtattttgaggatttcttta |
149 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34971882 |
tcaatgagttcaataagcaaagctccatccaacaataacatgataagttttgagtcttctgaggagagtagttggaccaagtattttgaggatttcttta |
34971783 |
T |
|
| Q |
150 |
acaatgatcagaaatgttctattaattctttctctgattttgatgatggctcttcttcccttgtctctg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34971782 |
acaatgatcagaaatgttctattaattctttctctgattttgatgatggctcttcttcccttgtctctg |
34971714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University