View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8175_low_95 (Length: 211)
Name: NF8175_low_95
Description: NF8175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8175_low_95 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 48716997 - 48716798
Alignment:
| Q |
1 |
tatacacttgtgatattatggttgaccaatgtcaccaaatattatatgtcactcaagtgcaacccaaagtttatggtgtatggtgcacacggcacatata |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48716997 |
tatacgcttgtgatattatggttgaccaatgtcaccaagtgctatatgtcactcaagtgcaacccaaagtttatggtgtatggtgcacacggcacatata |
48716898 |
T |
|
| Q |
101 |
tcttgcacctctcacaagattgttttttaatggattgctaagttatattattaaatgatataacgaagtttattgatgcaatggtagaaaataaacttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48716897 |
tcttgcacctctcacaagattgttttttaatggattgctaagttatattattaaatgatataacgaagtttattgatgccatggtagaaaataaacttat |
48716798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 17547052 - 17547091
Alignment:
| Q |
1 |
tatacacttgtgatattatggttgaccaatgtcaccaaat |
40 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17547052 |
tatacacttgtgacattatggttgaccaatgtcaccaaat |
17547091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 26561 - 26524
Alignment:
| Q |
1 |
tatacacttgtgatattatggttgaccaatgtcaccaa |
38 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
26561 |
tatacacttgtgatattgtgtttgaccaatgtcaccaa |
26524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University