View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8176_high_3 (Length: 242)
Name: NF8176_high_3
Description: NF8176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8176_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 17836647 - 17836421
Alignment:
| Q |
1 |
ttcactactaaaaccttactgggaatgaggatcatagctgtacataataaacatgtagtggcattatcaatgttgatgtacaatacatctgcaaatatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17836647 |
ttcactactaaaaccttactgggaatgaggatcatagttgtacataataaacatgcagtggcattatcaatgttgatgtacaatacaactgcaaatatat |
17836548 |
T |
|
| Q |
101 |
at----ccctgggggcacagatcctctaataggttagtaatgtacttctaaacagaccatgtcataaaattgaatatacatgcaatttctacagtatggt |
196 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17836547 |
atatacccctgggggcacagatcctctaataggttagtaatgtacttctaaacagaccctgtcataaaattgaatatacatgcaatttctacggtatggt |
17836448 |
T |
|
| Q |
197 |
tactcataattgtaaaagagtgctaac |
223 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
17836447 |
tgctcataattgtaaaagagtgctaac |
17836421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University