View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8177_high_13 (Length: 245)

Name: NF8177_high_13
Description: NF8177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8177_high_13
NF8177_high_13
[»] chr5 (1 HSPs)
chr5 (1-234)||(7597489-7597722)


Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 7597722 - 7597489
Alignment:
1 tggcctgtaaatccatttgaggattctggagtacaacaaagtcataagcagattgtacgtcaaatactgtaaatcaattagattagataaatgcccagca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||    
7597722 tggcctgtaaatccatttgaggattctggagtacaacaaagtcataagcagattgtaagtcaaatactgtaaatcaattagattggataaacgcccagca 7597623  T
101 ggaaaaagtcaaaacgtacccagtcactgtcataaagaatacaagtgtcggctgcagtgaggtttattcccaacccaccagccctggtggaaagaagaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7597622 ggaaaaagtcaaaacgtacccagtcactgtcataaagaatacaagtgtcggctgcagtgaggtttattcccaacccaccagccctggtggaaagaagaaa 7597523  T
201 gattctgcagttgctggttgtatcattgatgtcc 234  Q
    ||||||||||||||||||||||||||||| ||||    
7597522 gattctgcagttgctggttgtatcattgaagtcc 7597489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University