View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8177_high_14 (Length: 227)
Name: NF8177_high_14
Description: NF8177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8177_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 24 - 209
Target Start/End: Complemental strand, 17329156 - 17328971
Alignment:
| Q |
24 |
tcaacctcaacacacgaccatgacaattacctcgtatctgtcaaaggaacctcgtataagtcgaagtgttgttgcagtgaagtcacagctgagatatcct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17329156 |
tcaacctcaacacacgaccatgacaattacctcgtatctgtcaaaggaacctcgtataactcgaagtgttgttgcagtgaagtcacagctgagatatcct |
17329057 |
T |
 |
| Q |
124 |
atcatatcagctgatgatcattggggtgtttggtctgctatcttcagcattggtgcttttgggatttggtaattttattcattcat |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17329056 |
atcatatcatctgatgatcattggggtgtttggtctgctatcttcagcattggtgcttttgggatttggtaattttattcattcat |
17328971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 145 - 205
Target Start/End: Original strand, 30745965 - 30746025
Alignment:
| Q |
145 |
tggggtgtttggtctgctatcttcagcattggtgcttttgggatttggtaattttattcat |
205 |
Q |
| |
|
||||||||||| ||| | ||||||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
30745965 |
tggggtgtttgatctcccatcttcagcatcgatgcttttgggatttggtaatttcattcat |
30746025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University