View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8177_low_21 (Length: 218)
Name: NF8177_low_21
Description: NF8177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8177_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 12 - 203
Target Start/End: Original strand, 39578296 - 39578487
Alignment:
| Q |
12 |
agcagagacggttaaaagaaaacaatatgtttaaacaatagtacattacttattataattttttacgattaannnnnnnnagataaatagaggaggatta |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39578296 |
agcaaagacggttaaaagaaaacaatatgtttaaacaatagtacattacttattataattttttacgattaattttttttagataaatagaggaggatta |
39578395 |
T |
 |
| Q |
112 |
cacaagttgatatgacttatgcattcatctttgtattttgtgcatctctgagcaggctacaagggcttatcataggattcaacaattatact |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578396 |
cacaagttgatatgacttatgcattcgtctttgtattttgtgcatctctgagcaggctacaagggcttatcataggattcaacaattatact |
39578487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University