View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8177_low_5 (Length: 388)
Name: NF8177_low_5
Description: NF8177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8177_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 72 - 193
Target Start/End: Original strand, 4695062 - 4695182
Alignment:
| Q |
72 |
ttttgggtgaagaatttgatgggagannnnnnnnagaatttgaagctaaaagttatagtacaccgctaataactttggatttgagta----cttatttcg |
167 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| |||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4695062 |
ttttgggtgaagaatttgatggcagattttttttagaatttgaagctcaaagttatgct-----gctaataactttggatttgagtaaatacttatttcg |
4695156 |
T |
|
| Q |
168 |
ttcgatatctatttgccttgttaatc |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4695157 |
ttcgatatctatttgccttgttaatc |
4695182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 4694995 - 4695041
Alignment:
| Q |
1 |
aagagtggtaaaccaaccagaagcatttgtgtgcgatccattgttgc |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4694995 |
aagagtggtaaaccaaccagaaggatttgtgtgcgatccattgttgc |
4695041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 293
Target Start/End: Original strand, 4695725 - 4695763
Alignment:
| Q |
256 |
tgtatttgattctgttgttaaataa-ttagtgattattt |
293 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4695725 |
tgtatttgattctgttgttaaataatttagtgattattt |
4695763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University