View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8178_low_2 (Length: 239)
Name: NF8178_low_2
Description: NF8178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8178_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 223
Target Start/End: Original strand, 33032214 - 33032433
Alignment:
| Q |
7 |
gggtagattattctatgtctacacaaggattcacctcagtgagtatgaaattctgttgtgcaccacccgccccagattcttgtcgaaaactacctggcca |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33032214 |
gggtagatttttctatgtctacacaaggattcacctcagtgagtatgaaattctgttgagcaccacccgccccggattcttgtcgaaaactacctggcca |
33032313 |
T |
 |
| Q |
107 |
catcaactttgactcctcgtcttccaagaatattggaaatccgacgcaaccttgttgctcgaatctcatattatttctcacctc---atgatgaggccta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33032314 |
catcaactttgactcctcgtcttccaagaatattggaaatccgacgcaaccttgttgctcgaatctcatattatttctcacctcatgatgatgaggccta |
33032413 |
T |
 |
| Q |
204 |
attggtgttggtgagaaacc |
223 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
33032414 |
attgttgttggtgagaaacc |
33032433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University