View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8179_low_10 (Length: 323)
Name: NF8179_low_10
Description: NF8179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8179_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 306
Target Start/End: Original strand, 42694678 - 42694968
Alignment:
| Q |
18 |
aatataccaagtaccccagcaggaaatgtggctatggccatgtaccacacaaatggaacaacctgaaaccgacaagaacaacatatattagtttactcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694678 |
aatataccaagtaccccagcaggaaatgtggctatggccatgtaccacacaaatggaacaacctgaaaccgacaagaacaacatatattagtttactcaa |
42694777 |
T |
 |
| Q |
118 |
atcaaatttctactcacagaaatttttgtaatttaaaggtttgtctgtgtgtgctcatgtgaatatccaagtatctcagaca--tggataaacatgggtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
42694778 |
atcaaatttctactcacagaaatttttgtaatttaaaggtttgtctgtgtgtgctcatgtgaatatccaagtatctcagacatgtgtataaacatgggtg |
42694877 |
T |
 |
| Q |
216 |
tacatattttgtattcaagaaatgtaacaacacttatgatcttttgatcacttctttagtatttatatacggctttgacttctggtgttgg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694878 |
tacatattttgtattcaagaaatgtaacaacacttatgatcttttgatcacttctttagtatttatatacggctttgacttctggtgttgg |
42694968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University