View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8179_low_11 (Length: 316)
Name: NF8179_low_11
Description: NF8179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8179_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 127 - 303
Target Start/End: Complemental strand, 4544186 - 4544010
Alignment:
| Q |
127 |
gtgtccaaaatcatgnnnnnnnctatgtagtaaaagtaaaatacatgtgacaattcaccttcttatgcattgttcgacctcttaaataagtcgattggga |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4544186 |
gtgtccaaaatcatgtttttttctatgtagtaaaagtaaaatacatgtgacaattcaccttcttatgcattgttcgacctcttaaataagtcgattggga |
4544087 |
T |
 |
| Q |
227 |
gttaatacaaaaacaacgattggatcgtaactctgataaattttatttcattggaaattacgatccgttaaatctga |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4544086 |
gttaatacaaaaacaacgattggatcgtaactctgataaattttatttcattggaaattacgatccgttaaatctga |
4544010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 14 - 107
Target Start/End: Complemental strand, 4544308 - 4544215
Alignment:
| Q |
14 |
agagtaccagcaaggacaagcacgcaaaaatcgtaagtaccaacctatgctcgtgtgcacgacaaaacattaaccttatttttcacagtttaat |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4544308 |
agagtaccagcaaggacaagcacgaaaaaatcgtaagtaccaacctatgctcgtgtgcacgacaaaacattaaccttatttttcacagtttaat |
4544215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University