View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8179_low_15 (Length: 231)
Name: NF8179_low_15
Description: NF8179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8179_low_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 28439685 - 28439455
Alignment:
| Q |
1 |
agttctaattgaagatgaaatattctcttctcagagggcatctgcaacttgtcagatatcagtttattgatttaagctacgtaagtaaaactaataactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439685 |
agttctaattgaagatgaaatattctcttctcagagggcatctgcaacttgtcagatatcagtttattgatttaagctacgtaagtaaaactaataactt |
28439586 |
T |
|
| Q |
101 |
ttcaatttattgattcaagaggaaataaggctgttttcctgtagggttgtttggattggcttaacttttcaattttgaatgcagatttgggcctctggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439585 |
ttcaatttattgattcaagaggaaataaggctgttttcctgtagggttgtttggattggcttaacttttcaattttgaatgcagatttgggcctctggaa |
28439486 |
T |
|
| Q |
201 |
acttaagctctttggaaggtgaaaaataagc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28439485 |
acttaagctctttggaaggtgaaaaataagc |
28439455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University