View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8179_low_16 (Length: 231)
Name: NF8179_low_16
Description: NF8179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8179_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 206
Target Start/End: Complemental strand, 38876354 - 38876141
Alignment:
| Q |
2 |
tcatcgcttcattccaatttcagaaccaaactaaagttgccatctttttccatttctagaccaacccatttcaaggtttcacaaaattcaa--------- |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876354 |
tcatcgcttcattccaatttcagaaccaaactaaagttgccatctttttccatttctagaccaacccatttcaaggtttcacaaaattcaatcacaacca |
38876255 |
T |
|
| Q |
93 |
ctgaagaatcactctctaatgacttgctcattgtgggtcccggtgttcttggtcgcttggtagctcaaaaatggcgacatgtacgtactcttttcatctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38876254 |
ctgaagaatcactctctaatgacttgctcattgtgggtcccggtgttcttggtcgcttggtagctcaaaaatggcgacatgtacgtactcttttcatctt |
38876155 |
T |
|
| Q |
193 |
ctttcttttattgt |
206 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38876154 |
ctttcttttattgt |
38876141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University