View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8179_low_17 (Length: 227)
Name: NF8179_low_17
Description: NF8179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8179_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 47494523 - 47494302
Alignment:
| Q |
1 |
agatctgtccatctgtagaggtagtaaaatggttttcagaccacattatgctgaagttgtcttcaaaagatcccttagacatagctgcttctgctgaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47494523 |
agatctgtccatctgtagaggtagtaaaatggttttcagaccacattatgctgaagttgtcttcaaatgatcccttagacatagctgcttctgctgaatg |
47494424 |
T |
|
| Q |
101 |
atgataagcagctactatggctgcaaggaaaagaagaatggaaaatgaagaaaaggaccctccatccattttgggtaggaggagaattttggttcaagag |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47494423 |
atgataaacagctactatggctgcaaggaaaagaagaatggaaaatgaagaaaaggaccctccatccattttgggtaggaggagaattttggttcaagag |
47494324 |
T |
|
| Q |
201 |
aatggagggattctctgcttct |
222 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
47494323 |
aatggagagattctctgcttct |
47494302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University