View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_103 (Length: 297)
Name: NF8180A_low_103
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_103 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 51960428 - 51960143
Alignment:
| Q |
1 |
tcagccacgaggagagggagggtagcacgttgctagctgtggaatggaggagtgggccggcaggtcctttcctacannnnnnnnatcataaacacaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
51960428 |
tcagccacgaggagagggagggtagcacgttgctagctgtggaatggaggagtgggccggcaggtcctttcctacattttttt-attataaacacaggga |
51960330 |
T |
|
| Q |
101 |
tagtagcctcgtgtcaacgctaataaagggtcatgaactcgcgattcacaagcataaactttccacaaacacccgtttggtaagaggtaagagcataatt |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51960329 |
tagt-gcctcgtgtcaacgctaataaagggtcatgaactcgcgattcacaagcttaaactttccacaaacacccgtttggtaagaggtaagagcttaatt |
51960231 |
T |
|
| Q |
201 |
gattagtccttgat---tgctgggctggaagaaataatgcattgttatatgtatgaacaatagtttagtccttattaatcagtatatt |
285 |
Q |
| |
|
|||||||||||| | |||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
51960230 |
gattagtccttgttaggtgctcggctgacagaaataatgcattgttatatgtatgaacgatagtttagtccttattaatcactatatt |
51960143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University