View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_108 (Length: 294)
Name: NF8180A_low_108
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 62 - 278
Target Start/End: Original strand, 2181324 - 2181540
Alignment:
| Q |
62 |
taaatgagttttatatatgtagtttatgatacgatgtagaattttaccctactctattggatggtaaaagaattggacgattaaaagtcttacagacttt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
2181324 |
taaatgagttttatatatgtagtttatgatatgatgtagaagtttaccctactctattggatggtaaaaggattggacgattaaatgtcttacagacttt |
2181423 |
T |
 |
| Q |
162 |
tcgtattcataaatcataatactatagccattcttaaatatttgattgatcaattctttgtaataatttgtatcatttttaaaatttacagatttaccat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2181424 |
tcgtattcataaatcataatactatagccattcttaaatatttgattgatcaattctttgtaataatttgtatcatttttaaaatttacagatttaccat |
2181523 |
T |
 |
| Q |
262 |
tcgtggaacatgagata |
278 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2181524 |
tcgtggaacatgagata |
2181540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 2181236 - 2181291
Alignment:
| Q |
5 |
caatttattgccaatatccgaacaaaattgtttaccgtaggaggtaccttaactct |
60 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2181236 |
caatttattgccaatatccaaacaaaattgtttaccgtaggagttaccttaactct |
2181291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University