View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_133 (Length: 279)
Name: NF8180A_low_133
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_133 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 263
Target Start/End: Original strand, 37918344 - 37918382
Alignment:
| Q |
225 |
aggaattaaggttattagatttgatggtattggtttggt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37918344 |
aggaattaaggttattagatttgatggttttggtttggt |
37918382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 79
Target Start/End: Original strand, 37918193 - 37918222
Alignment:
| Q |
50 |
ggtgtgagtttagatgatgcatttttggag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37918193 |
ggtgtgagtttagatgatgcatttttggag |
37918222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University