View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_141 (Length: 277)
Name: NF8180A_low_141
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_141 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 37459943 - 37459816
Alignment:
| Q |
1 |
tcagtttcggtttgtttaaagtttcaagattctttgttgttgatttaattaggttaaatcagggtcaatgaaaatcagttttggtttgttttatagggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37459943 |
tcagtttcggtttgtttaaagtttcaagattctttgttgttgatttaattaggttaaatcagggtcaatgaaaatcagttttggtttgttttatagggtt |
37459844 |
T |
|
| Q |
101 |
atggttttaagattctttgttgatttaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37459843 |
atggttttaagattctttgttgatttaa |
37459816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 125 - 265
Target Start/End: Complemental strand, 37459795 - 37459656
Alignment:
| Q |
125 |
ttaagaaggctattgattgtgtttaggttaaaaggtgttaatgtgagagccttggactagaatttgacttcgatggactacgnnnnnnnnattgctaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37459795 |
ttaagaaggctattgattgtgtttaggttaaaaggtgttaatgtgagagccttggactagaatttgacttcgatggactacg-tttttttattgctaatt |
37459697 |
T |
|
| Q |
225 |
ttgattttatttgattattctcgtactgatttcgcctttct |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37459696 |
ttgattttatttgattattctcgtactgatttcgcctttct |
37459656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University