View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_156 (Length: 267)
Name: NF8180A_low_156
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_156 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 262
Target Start/End: Complemental strand, 10126549 - 10126297
Alignment:
| Q |
10 |
ataatactgctatttattaacttggaatgtggaaataaatcatagataaaaaccaaaatgttttacttttttgttcgagaaaagtactatttttggaaga |
109 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
10126549 |
ataatgctgctatttattaacttggaatatggaaataaatcatagatgaaaaccaaaatgttttacttttttgttcgagaaacgtactatgtttggaaga |
10126450 |
T |
|
| Q |
110 |
tattcaatccaatttttcaccagatctcaataatcgctaccttatccttcatcaaagattgataggcataatggttgcattaaaactaaaatggatgttc |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10126449 |
tatccaatccaatttttcaccagatctcaataatcggtaccttatctttcatcaaagattgataggcataatgcttgcattaaaactaaaatggatgttc |
10126350 |
T |
|
| Q |
210 |
tgcagccgattttgtggtttttctctcctgcctaatggtctgtagactgtatt |
262 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
10126349 |
tgcagccgattttgtggtttttctctctcgtttaatggtctgtagactgtatt |
10126297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University