View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8180A_low_167 (Length: 261)

Name: NF8180A_low_167
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8180A_low_167
NF8180A_low_167
[»] chr7 (2 HSPs)
chr7 (1-171)||(22270322-22270498)
chr7 (167-216)||(22269296-22269345)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 22270498 - 22270322
Alignment:
1 agcacagtgacatatctctcgagaaaagccgatatataaaaagtaaacttcctttaggtatnnnnnnn------ggtaattaaggttttataccttggtc 94  Q
    |||||| ||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||             ||||||||| |||||||| |||||||    
22270498 agcacaatgacatatctcccgagaaaaaccgatatataaaaactaaacatcctttaggtataaaaaaaaaagaaggtaattaacgttttatatcttggtc 22270399  T
95 taaagttggaactggtttggtttggagcttagtttatcttcatatttatgcggacgtagaaaaccttattttgttaa 171  Q
    ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||    
22270398 taaagtttgaactggtttggtttggagcttagtttatgttcatatttatgcggacgtaaaaaaccttattttgttaa 22270322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 22269345 - 22269296
Alignment:
167 gttaacacttaattttatcagtagattgatatgcaaataatactttcctc 216  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||    
22269345 gttaacacttaattttattagtagattggtatgcaaataatactttcctc 22269296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University