View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_168 (Length: 261)
Name: NF8180A_low_168
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_168 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 31809180 - 31809341
Alignment:
| Q |
1 |
atgctcccaaaactcgttcgttgagttcgaccagttcaaagcccaagcccaaacccaagtccacttcaacgggctccagaggaagaaagaaagcccgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809180 |
atgctcccaaaactcgttcgttgagttcgaccagttcaaagcccaagcccaaacccaagtccacttcaacgggctccagaggaagaaagaaagcccgtgt |
31809279 |
T |
 |
| Q |
101 |
ttccagttcagcgcctcgtctctctaagctttacgaggtaatatcaattaatctgaataatc |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809280 |
ttccagttcagcgcctcgtctctcgaagctttacgaggtaatatcaattaatctgaataatc |
31809341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 178 - 259
Target Start/End: Original strand, 31809388 - 31809469
Alignment:
| Q |
178 |
atgaactttgtattatgttgctaccatttttgtgtcacgcgtatttttcatttcactgtaccttagttctaattgcattttt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809388 |
atgaactttgtattatgttgctaccatttttgtgtcacgcgtatttttcatttcactgtaccttagttctaattgcattttt |
31809469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University