View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_173 (Length: 259)
Name: NF8180A_low_173
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_173 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 55654467 - 55654648
Alignment:
| Q |
17 |
aatatcaaacacactcttgtatatattgaccaatttgaatccgctataagattaatttttgagttaacgatcgctaatactatatcttccaaatgtgcga |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
55654467 |
aatatcaaacacactctcgtatatattgaccaatttaaatccactataagattaatttttaagttaacgatcgttag-actatatcttccaaatgtgcga |
55654565 |
T |
 |
| Q |
117 |
ctccatgaattgaacctagattgtttttctaagtaaggtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55654566 |
ctccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
55654648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University