View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_177 (Length: 258)
Name: NF8180A_low_177
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_177 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 5251406 - 5251172
Alignment:
| Q |
7 |
ttcattcctttgtatannnnnnncgattgttttaaaattatcatggatgaacctgtttgttaaaattgtttgcattatacacttatctttcatttccttc |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5251406 |
ttcattcctttgtatatttttttcgattgttttaaaattatcatggatgaacctgtttgttaaaattgtttgcattat----------ttcatttccttc |
5251317 |
T |
 |
| Q |
107 |
gcttcatcatcgctctagtgcttaaccactattcttatgnnnnnnnnnnnnnnnnngacaaaaaccactattcttatgctgtaacacttgttttttgtgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5251316 |
gcttcatcatcgctctagtgcttaaccactattcttatttattttattattttttat-caaaaaccactattcttatgttgtaacacttgttttttgtgc |
5251218 |
T |
 |
| Q |
207 |
tttcagcaaagaaacattttatatataaaatccaacatcaacacca |
252 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5251217 |
tttctgcaaagaaacattttatatataaaatccaacatcaacacca |
5251172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University