View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_179 (Length: 257)
Name: NF8180A_low_179
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_179 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 48482604 - 48482373
Alignment:
| Q |
8 |
taacacagacgctaatatattgtgcagttcacaggtttgagctctggtctttcaattatgctaatcttattttccatgtgttcttttgaaaaactgtttt |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482604 |
taacacagacgctaatatattgcgcagttcacaggtttgagctctggtcttccaattatgctaatcttattttccatgtgttcttttgaaaaactgtttt |
48482505 |
T |
 |
| Q |
108 |
tacattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctctccaagaacttcacttcaaaatcac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482504 |
tacattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctctccaagaacttcacttcaaaatcac |
48482405 |
T |
 |
| Q |
208 |
aagggacgctttagaggatcaaagcttatttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48482404 |
aagggacgctttagaggatcaaagcttatttc |
48482373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University