View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_184 (Length: 255)
Name: NF8180A_low_184
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_184 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 34449274 - 34449028
Alignment:
| Q |
1 |
gaaggcacaggagaaaggcattcaggcttctgaaaatgaaattccatttattgaccaagggcaccaaaccaaatgaccacggccctcagcccttctaccc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34449274 |
gaaggcacaggagaaaggtattcaggcttctgaaaatgaaattccatttattgaccaagggcaccaaaccaaatgaccacggccctcagcccttctaccc |
34449175 |
T |
|
| Q |
101 |
cacagattgagagagagaaccaaacttagactttttaatgttttcaaaggtgttcagaaatttaagtttgatcagcttaggcagactaatgaagccattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34449174 |
-acagattgagagagagaaccaaacttagactttttaatgttttcaaaggtgttcaaaaatttaagtttgatcagcttaggcagactaatgaagccattt |
34449076 |
T |
|
| Q |
201 |
tgtcagtcaagtcaacccagactgatgcattataactcaagaataata |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34449075 |
tgtcagtcaagtcaacccagactgatgcattataactcaagtataata |
34449028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University