View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_197 (Length: 250)
Name: NF8180A_low_197
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_197 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 42706800 - 42706576
Alignment:
| Q |
9 |
agatgatgcgatgtagtctgtaacttccatttgtttcttcataggcatttgagcttcacgctttctagatatttgttcttgaggctgtagtagggctcat |
108 |
Q |
| |
|
||||||||| |||| |||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42706800 |
agatgatgccatgttgtctgtaatttccatctgtctcttcataggcatttgagcttcacgctttctagatatttttccttgaggctgtagtagggctcat |
42706701 |
T |
 |
| Q |
109 |
gagttgtaaagagactcagagtgattggttttc-tgtgcattgttgtagatgtgagtcttgggtggaggagtgtgagcctgagtgaaaccctgatcaggg |
207 |
Q |
| |
|
| |||||||||||||| | |||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42706700 |
gcgttgtaaagagacttatagtgattggtttccttgagcattgttgtagatgtgagtcttgggtggaggagtgtgagcctgagtgaaaccctgatcaggg |
42706601 |
T |
 |
| Q |
208 |
gctttgcctcctgatttgttgatgt |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42706600 |
gctttgcctcctgatttgttgatgt |
42706576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University