View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_207 (Length: 249)
Name: NF8180A_low_207
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_207 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 125 - 229
Target Start/End: Complemental strand, 14560780 - 14560676
Alignment:
| Q |
125 |
attggcaatgaactcgtgtaaatgcagatgtggacatcaaaatgcagatgaacactggggttattaagctttctcttgtaactactaaaataaaaagtgc |
224 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14560780 |
attggaaatgaacccgtgtaaatgcagatgtggacatcaaaatgcagatgaacactggggttattaagctttctcttgtaactactaacgtaaaaagtgc |
14560681 |
T |
|
| Q |
225 |
ctgat |
229 |
Q |
| |
|
||||| |
|
|
| T |
14560680 |
ctgat |
14560676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 20 - 125
Target Start/End: Original strand, 33353708 - 33353816
Alignment:
| Q |
20 |
attgggttttatctgataatggcttacaaacttaaggatatgatga---tgtttcatgaccttaatgttggtaagagagtgtttaattttttaagacaca |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33353708 |
attgggttttatctgataatggctttcaaacttaaggatatgatgaagatgtttcatgaccttaatgctggtaagagagtgtttaattttttaagacaca |
33353807 |
T |
|
| Q |
117 |
ctcctaaca |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
33353808 |
ctcctaaca |
33353816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University