View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_221 (Length: 246)
Name: NF8180A_low_221
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_221 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 55 - 224
Target Start/End: Original strand, 51739037 - 51739205
Alignment:
| Q |
55 |
ttgttaaaacgtaaaatttcatatcagattcctttctttgtctaatttattgattgaagttttgacaaacacattaaatgcacacaatggatgccacaca |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||| || |
|
|
| T |
51739037 |
ttgttaaaacgtaaaatttcatatcagattcctttctttgtctaatttattgattga-gttttgacaaaaacattaaatccacacaatggatgccaccca |
51739135 |
T |
 |
| Q |
155 |
caaaatgttttgtaataaagaactagttaaccctctatactcaatgggcatgcaagtgtcatgtattctt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739136 |
caaaatgttttgtaataaagaactagttaaccctctatactcaatgggcatgcaagtgtcatgtattctt |
51739205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University