View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_235 (Length: 244)
Name: NF8180A_low_235
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_235 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 26871906 - 26872110
Alignment:
| Q |
18 |
gaaattacacacactacacacgctcacacaaatctatcttagtgaagaaaagggtgcaggtagcagatattgcatttagagaacttgaagtgatatcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26871906 |
gaaattacacacactacacacgctcacacaaatctatcg-agtgaagaaaagggtgcaggtagcagatattgcatttagacaacttgaagtgatatcatt |
26872004 |
T |
 |
| Q |
118 |
tagaaatataacatggtttgttaagaactactcttggacagtagtgaatgtaagagactaagaaaagtgaaggagaaacatttttctctttaggctacca |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26872005 |
tggaaatataacatggtttgttaagaactactcttggacagtagtgaatgtaagagactaagaaaagtgaaggagaaacatttttctctttaggctacca |
26872104 |
T |
 |
| Q |
218 |
cagtaa |
223 |
Q |
| |
|
|||||| |
|
|
| T |
26872105 |
cagtaa |
26872110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University