View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_236 (Length: 244)
Name: NF8180A_low_236
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_236 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 27025270 - 27025473
Alignment:
| Q |
21 |
atactatacatacattatacatatatctagaattaatttttctaccctttgagacatgattctcaaagtcaacaaaacctggttctcctatatgtttcat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27025270 |
atactatacatacattatacatatatctagaattaatttttctaccctttgagacatgattctcaaagtcaacaaaacctggttctcctatatgtttcat |
27025369 |
T |
|
| Q |
121 |
tatccaaatgttaccatatcaccattcacaatcaaactgaaaaggctgaatgtatcaatatcatcactgcatattcacaatcaaattgaaaaggctgaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27025370 |
tatccaaatgttaccatatcaccattcacaatcaaactgaaaaggctgaatgtatcaatatcatcactgcatattcacaatcaaattgaaaaggctgaat |
27025469 |
T |
|
| Q |
221 |
gtac |
224 |
Q |
| |
|
|||| |
|
|
| T |
27025470 |
gtac |
27025473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University