View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_248 (Length: 242)
Name: NF8180A_low_248
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_248 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 68 - 236
Target Start/End: Complemental strand, 41551146 - 41550978
Alignment:
| Q |
68 |
taagaataagatgaattgaacaaacattgcaagattatgataaattgagatttgaagaaagaaattgacctatgcattgaccgaaatcaacgcgatgaag |
167 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551146 |
taagaataagatgcattgaacaaacattgcaagattatgataaattgagatttgaagaaagaaattgacctatgcattgaccgaaatcaacgcgatgaag |
41551047 |
T |
 |
| Q |
168 |
aaaaccgtctttcgcaagcttatcaaaattcttctgcacttcgttccacgcatcaacaccgttggattt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41551046 |
aaaaccgtctttcgcaagcttatcaaaattcttctgcacttcgttccacgcatcaacaccgttggattt |
41550978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University