View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8180A_low_257 (Length: 239)
Name: NF8180A_low_257
Description: NF8180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8180A_low_257 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 12123760 - 12123989
Alignment:
| Q |
7 |
atataaacgaataagacgttttttctttg-----gtaagttcaaaaggatcaatcaaattggtaaatgaagagcttacnnnnnnnnn-cagtatctttct |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
12123760 |
atataaacgaataagatgttttttcttttctttagtaagttcaaaaggatcaatcaaattgataaatgaagagcttacttttttttttcattatctttct |
12123859 |
T |
 |
| Q |
101 |
nnnnnnnnntaaactatttgtattctcaacctcttaactaaattttggtagtttaaaataactagtaaaaagaaagacttaagatattattttatggaga |
200 |
Q |
| |
|
||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12123860 |
aaaaaaaaataa-ctatttctattctcaacctcttacctaaattttggtagtttaaaataactagtaaaacgaaagacttaagatattattttatggaga |
12123958 |
T |
 |
| Q |
201 |
ggtctccatcctttttcttgtggtgaatatt |
231 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |
|
|
| T |
12123959 |
ggtctccatcctttttcttgttgagaatatt |
12123989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University